The GEBA-MDM project overview

  • Print
Details
Hits: 3930

Reconstructing bacterial and archaeal genomes has revolutionized our understanding of microbial metabolism as well as evolutionary processes, and significantly sped up discoveries made in bioprospecting. We have surpassed the 5,000 mark for bacterial and archaeal sequenced genomes worldwide, yet the great majority of bacterial and archaeal genomes sequenced to date are of rather limited phylogenetic diversity. These findings gave rise to the initiation of the Genomic Encyclopedia of Bacteria and Archaea (GEBA) Project 1, which populated the tree of life with phylogenetically diverse reference genomes. While the bulk of all sequenced microbial genomes are derived from cultivated representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes of these largely mysterious species. Following in the footsteps of the GEBA project, we initiated the Microbial Dark Matter (MDM) Project in 2011 to massively expand genomic representation further by targeting 200 representatives of candidate phyla (phyla proposed on the basis of environmental sequences that have no cultivated representatives) via high throughout single-cell sequencing.

Read more: The GEBA-MDM project overview

Single Cell Data

  • Print
Details
Hits: 4328

Here I provide an overview of all our 201 Single-cell Amplified Genomes (SAGs). It includes the NCBI accession number, the IMG taxon ID, organism name, etc.
This table should make it easier to find single cell data in IMG and NCBI.

Read more: Single Cell Data

MDM press coverage

  • Print
Details
Hits: 2980

The GEBA-MDM project received quite some attention in the media, here is a selection of articles and press releases:

Bringing Microbial Dark Matter Into the Light
by WIRED science

Canadian lake offers new glimpse at 'tree of life'
by CBC News

Scientific breakthrough unlocks secrets of microbes
by The Independent

Genomes of 201 microbes sequenced
by BBC News

"Microbial Dark Matter" --The Final Frontier: The Invisible Infrastructure of Life on Earth
by dailygalaxy

16S rRNA sequences

  • Print
Details
Hits: 5013

This the summary of all 16S rRNA sequences retrieved from the 201 Single Amplified Genomes (SAGs) in the GEBA-MDM project. The sequences were amplified by rtPCR using the following primers: Forward 926wF (GAAACTYAAAKGAATTGRCGG) and reverse 1392R (ACGGGCGGTGTGTRC). In addition full length SSU amplification was performed using the primers: 27F (AGAGTTTGATCCTGGCTCAG) for Bacteria, 4aF (TCCGGTTGATCCTGCCRG) for Archaea, together with the universal reverse primer 1391R (GACGGGCGGTGWGTRCA). For some SAGs 16S sequences were also retrieved from the shotgun genome sequencing. The most complete sequence was chosen for this final dataset of 16S rRNA sequences.

Read more: 16S rRNA sequences