16S rRNA sequences

This the summary of all 16S rRNA sequences retrieved from the 201 Single Amplified Genomes (SAGs) in the GEBA-MDM project. The sequences were amplified by rtPCR using the following primers: Forward 926wF (GAAACTYAAAKGAATTGRCGG) and reverse 1392R (ACGGGCGGTGTGTRC). In addition full length SSU amplification was performed using the primers: 27F (AGAGTTTGATCCTGGCTCAG) for Bacteria, 4aF (TCCGGTTGATCCTGCCRG) for Archaea, together with the universal reverse primer 1391R (GACGGGCGGTGWGTRCA). For some SAGs 16S sequences were also retrieved from the shotgun genome sequencing. The most complete sequence was chosen for this final dataset of 16S rRNA sequences.

 

You can find the 16S fasta file with all 201 sequences here : files/16S_201x_SAGs_fasta.txt

The table below provides the name of the fasta file headers, the genome name and the SAG ID:

name genome name SAG ID
CvAYyyyy Acetothermia bacterium SCGC_AAA255-C06 122
CtUYyyyy Aenigmarchaeota archaeon SCGC_AAA011-F07 186
CUAYyyyy Aenigmarchaeota archaeon SCGC_AAA011-O16 271
DHEYyyyy Aenigmarchaeota archaeon JGI_0000106-F11 281
CJGYyyyy Aerophobetes bacterium JGI_0000014-C22 222
CJIYyyyy Aerophobetes bacterium JGI_0000014-A15 223
CibYyyyy Aerophobetes bacterium SCGC_AAA252-L23 70
CvFYyyyy Aerophobetes bacterium SCGC_AAA255-F10 129
CJ1Yyyyy Aigarchaeota archaeon JGI_0000001-B8 113
CJ2GYyyy Aigarchaeota archaeon JGI_0000001-H6 118
CnJYyyyy Aigarchaeota archaeon JGI_0000001-A7 112
CJJYyyyy Aigarchaeota archaeon JGI_0000106-J15 288
CGAYyyy2 Aigarchaeota archaeon SCGC_AAA471-J08 19
CGAYyyyy Aigarchaeota archaeon SCGC_AAA471-J07 18
CGCYyyyy Aigarchaeota archaeon SCGC_AAA471-G05 14
CiLYyyyy Aigarchaeota archaeon SCGC_AAA471-D15 9
CioYyyy2 Aigarchaeota archaeon SCGC_AAA471-B22 4
CpIYyyyy Aigarchaeota archaeon SCGC_AAA471-I13 17
CvhYyyyy Aigarchaeota archaeon SCGC_AAA471-F17 13
CvnYyyyy Aigarchaeota archaeon SCGC_AAA471-A16 1
CvpYyyy2 Aigarchaeota archaeon SCGC_AAA471-E16 11
CvpYyyyy Aigarchaeota archaeon SCGC_AAA471-E14 10
CJBYyyyy Aminicenantes bacterium JGI_0000014-B08 226
CGBYyyy2 Aminicenantes bacterium SCGC_AAA252-B17 33
COAYyyy3 Aminicenantes bacterium SCGC_AAA252-O03 81
COAYyyy4 Aminicenantes bacterium SCGC_AAA252-O09 83
COAYyyy5 Aminicenantes bacterium SCGC_AAA252-O10 84
COAYyyy6 Aminicenantes bacterium SCGC_AAA252-O11 85
COAYyyy7 Aminicenantes bacterium SCGC_AAA252-O19 88
COAYyyyy Aminicenantes bacterium SCGC_AAA255-O15 137
COGYyyy2 Aminicenantes bacterium SCGC_AAA252-K06 60
COGYyyy3 Aminicenantes bacterium SCGC_AAA252-K07 61
COGYyyy4 Aminicenantes bacterium SCGC_AAA252-K18 63
COGYyyyy Aminicenantes bacterium SCGC_AAA255-K14 134
CavYyyy4 Aminicenantes bacterium SCGC_AAA252-L02 64
CavYyyy5 Aminicenantes bacterium SCGC_AAA252-L10 67
CedYyyy2 Aminicenantes bacterium SCGC_AAA252-P19 93
CedYyyyy Aminicenantes bacterium SCGC_AAA252-P13 91
CiPYyyyy Aminicenantes bacterium SCGC_AAA252-I14 54
CinYyyy2 Aminicenantes bacterium SCGC_AAA252-D18 40
CinYyyyy Aminicenantes bacterium SCGC_AAA252-D06 38
CsOYyyy2 Aminicenantes bacterium SCGC_AAA252-G04 47
CsOYyyy3 Aminicenantes bacterium SCGC_AAA252-G05 48
CsOYyyy4 Aminicenantes bacterium SCGC_AAA252-G06 49
CsOYyyy5 Aminicenantes bacterium SCGC_AAA252-G21 52
CtJYyyy3 Aminicenantes bacterium SCGC_AAA252-J09 57
CtJYyyy4 Aminicenantes bacterium SCGC_AAA252-J15 58
CtJYyyy5 Aminicenantes bacterium SCGC_AAA252-J21 59
CvAYyyy2 Aminicenantes bacterium SCGC_AAA252-C08 36
CvEYyyy2 Aminicenantes bacterium SCGC_AAA255-E05 125
CvEYyyy3 Aminicenantes bacterium SCGC_AAA255-E10 126
CvOYyyy3 Aminicenantes bacterium SCGC_AAA255-F06 127
CvOYyyy4 Aminicenantes bacterium SCGC_AAA255-F09 128
CvOYyyy7 Aminicenantes bacterium SCGC_AAA252-F08 46
CvmYyyy4 Aminicenantes bacterium SCGC_AAA252-A02 31
CvmYyyy5 Aminicenantes bacterium SCGC_AAA255-A06 119
CvtYyyy3 Aminicenantes bacterium SCGC_AAA252-N06 75
CvtYyyy4 Aminicenantes bacterium SCGC_AAA252-N07 76
ArJYyyyy Armatimonadetes bacterium JGI_0000077-K19 240
COFYyyy2 Atribacteria bacterium JGI_0000014-F07 227
CGDYyyyy Atribacteria bacterium SCGC_AB-164-D21 216
CGMYyyyy Atribacteria bacterium SCGC_AB-164-M20 218
CGPYyyyy Atribacteria bacterium SCGC_AB-164-P05 215
CaGYyyyy Atribacteria bacterium SCGC_AB-164-L03 213
CiaYyyyy Atribacteria bacterium SCGC_AB-164-A22 219
CidYyyyy Atribacteria bacterium SCGC_AB-164-G04 217
CirYyyyy Atribacteria bacterium SCGC_AAA252-M02 71
CsOYyyyy Atribacteria bacterium SCGC_AAA255-G05 130
CvEYyyyy Atribacteria bacterium SCGC_AAA255-E04 124
CvtYyyy2 Atribacteria bacterium SCGC_AAA255-N14 136
CJLYyyyy Atribacteria bacterium JGI_0000079-L04 231
COFYyyy3 Atribacteria bacterium JGI_0000079-F20 232
COJYyyyy Atribacteria bacterium JGI_0000059-I14 167
B77Yyyyy BRC1 bacterium SCGC_AAA257-C11 139
CiuYyyyy BRC1 bacterium SCGC_AAA252-M09 73
CcIYyyyy Caldiserica bacterium JGI_0000059-M03 171
CEGYyyyy Calescamantes bacterium JGI_0000106-G12 282
CEIYyyy2 Calescamantes bacterium JGI_0000106-I17 286
CEIYyyy3 Calescamantes bacterium JGI_0000106-I5 287
CEPYyyyy Calescamantes bacterium JGI_0000106-P5 294
CEbYyyy2 Calescamantes bacterium JGI_0000106-H18 283
CEcYyyy2 Calescamantes bacterium JGI_0000106-N5 291
CEcYyyy3 Calescamantes bacterium JGI_0000106-N7 292
CIJYyyyy Calescamantes bacterium JGI_0000106-J16 289
CIMYyyyy Calescamantes bacterium JGI_0000106-M22 290
CErYyyyy Calescamantes bacterium SCGC_AAA471-M6 25
CWJYyyyy Cloacimonetes bacterium JGI_0000014-H19 275
CWmYyyy2 Cloacimonetes bacterium JGI_0000014-D18 274
CWmYyyyy Cloacimonetes bacterium JGI_0000014-D06 273
CsIYyyy2 Cloacimonetes bacterium JGI_0000014-K11 276
CKAYyyy2 Cloacimonetes bacterium SCGC_AAA252-E13 43
CKAYyyy3 Cloacimonetes bacterium SCGC_AAA252-E20 44
CKBYyyy2 Cloacimonetes bacterium SCGC_AAA252-G07 50
CKBYyyy3 Cloacimonetes bacterium SCGC_AAA252-G08 51
CKFYyyyy Cloacimonetes bacterium SCGC_AAA252-F02 45
CKGYyyyy Cloacimonetes bacterium SCGC_AAA252-D03 37
CKIYyyy2 Cloacimonetes bacterium SCGC_AAA252-I16 56
CKIYyyyy Cloacimonetes bacterium SCGC_AAA252-I11 53
CKKYyyyy Cloacimonetes bacterium SCGC_AAA252-K16 62
CKNYyyy2 Cloacimonetes bacterium SCGC_AAA252-N11 77
CKNYyyy3 Cloacimonetes bacterium SCGC_AAA252-N14 78
CKNYyyy4 Cloacimonetes bacterium SCGC_AAA252-N17 79
CKNYyyyy Cloacimonetes bacterium SCGC_AAA252-N05 74
CKOYyyy4 Cloacimonetes bacterium SCGC_AAA252-O17 87
CKOYyyyy Cloacimonetes bacterium SCGC_AAA252-O02 80
CKPYyyy2 Cloacimonetes bacterium SCGC_AAA252-P10 90
CKPYyyy3 Cloacimonetes bacterium SCGC_AAA252-P14 92
CKPYyyyy Cloacimonetes bacterium SCGC_AAA252-P02 89
CKSYyyyy Cloacimonetes bacterium SCGC_AAA255-C20 123
CKcYyyy2 Cloacimonetes bacterium SCGC_AAA252-L05 66
CKcYyyy3 Cloacimonetes bacterium SCGC_AAA252-L13 68
CKcYyyyy Cloacimonetes bacterium SCGC_AAA255-L20 135
CiKYyyyy Cloacimonetes bacterium SCGC_AAA252-M08 72
CvKYyyyy Cloacimonetes bacterium SCGC_AAA255-B16 121
CWWYyyy2 Cloacimonetes bacterium JGI_0000059-L07 170
CWbYyyy2 Cloacimonetes bacterium JGI_0000059-P03 173
CWbYyyy3 Cloacimonetes bacterium JGI_0000059-P11 174
CWcYyyyy Cloacimonetes bacterium JGI_0000059-F17 166
CWEYyyyy Cloacimonetes bacterium JGI_0000039-M09 159
CWbYyyyy Cloacimonetes bacterium JGI_0000039-P09 162
CtIYyyyy Cloacimonetes bacterium JGI_0000039-A21 148
CvJYyyy3 Cloacimonetes bacterium JGI_0000039-I17 155
CvWYyyyy Cloacimonetes bacterium JGI_0000039-G13 152
CUEYyyyy Diapherotrites archaeon SCGC_AAA011-K09 199
CULYyyyy Diapherotrites archaeon SCGC_AAA011-E11 206
CEhYyyyy Diapherotrites archaeon SCGC_AAA011-N19 272
CEJYyyyy EM3 bacterium JGI_0000106-B10 280
CiCYyyyy Euryarchaeota archaeon SCGC_AAA252-I15 55
CAJYyyyy Fervidibacteria bacterium JGI_0000001-B9 114
CJDYyyy0 Fervidibacteria bacterium JGI_0000001-D5 115
CJHYyyyy Fervidibacteria bacterium JGI_0000054-H05 175
CuJGYyyy Fervidibacteria bacterium JGI_0000001-G10 117
B01Yyyyy Fervidibacteria bacterium SCGC_AAA471-D06 7
CdYYyyyy Geoarchaeota archaeon SCGC_AAA471-L13 22
CnYYyyy2 Geoarchaeota archaeon SCGC_AAA471-B23 5
CnYYyyyy Geoarchaeota archaeon SCGC_AAA471-B05 2
CtYYyyyy Geoarchaeota archaeon SCGC_AAA471-O08 29
CvYYyyyy Geoarchaeota archaeon SCGC_AAA471-C03 6
QCQYyyy2 Geoarchaeota archaeon SCGC_AAA471-L14 23
CGKYyyyy Gracilibacteria bacterium JGI_0000069-K10 277
CGrYyyyy Gracilibacteria bacterium JGI_0000068-E11 255
CJPYyyyy Gracilibacteria bacterium JGI_0000069-P22 278
CKmYyyyy Hydrogenedentes bacterium JGI_0000077-D07 236
CKrYyyy2 Hydrogenedentes bacterium JGI_0000077-O16 237
CKtYyyyy Hydrogenedentes bacterium JGI_0000059-N10 172
CvIYyyyy Hydrogenedentes bacterium JGI_0000039-J10 156
CtWYyyyy Latescibacteria bacterium SCGC_AAA257-K07 145
CWAYyyyy Latescibacteria bacterium SCGC_AAA252-E07 42
CWGYyyyy Latescibacteria bacterium SCGC_AAA252-B13 32
CdWYyyy2 Latescibacteria bacterium SCGC_AAA252-D10 39
B76SYyyy Marinimicrobia bacterium SCGC_AAA011-A05 181
SbGYyyyy Marinimicrobia bacterium SCGC_AAA257-N23 146
SiJYyyyy Marinimicrobia bacterium JGI_0000090-C20 259
B78Fasta Marinimicrobia bacterium SCGC_AAA160-I06 777
B80Fasta Marinimicrobia bacterium SCGC_AAA160-C11 779
B81Fasta Marinimicrobia bacterium SCGC_AAA160-B08 780
B82Fasta Marinimicrobia bacterium SCGC_AAA076-M08 781
B79Fasta Marinimicrobia bacterium SCGC_AAA298-D23 778
SbBYyyyy Marinimicrobia bacterium JGI_0000077-B04 234
SbIYyyy2 Marinimicrobia bacterium JGI_0000059-E23 165
SbJYyyy2 Marinimicrobia bacterium JGI_0000059-D20 164
SmIYyyyy Marinimicrobia bacterium JGI_0000059-L03 169
SbIYyyyy Marinimicrobia bacterium JGI_0000039-E15 150
SbJYyyyy Marinimicrobia bacterium JGI_0000039-D08 149
SbOYyyyy Marinimicrobia bacterium JGI_0000039-O11 161
SbAYyyyy Marinimicrobia bacterium SCGC_AAA003-E22 268
SusYyyyy Marinimicrobia bacterium SCGC_AAA003-L8 269
CedYyyy3 Microgenomates bacterium SCGC_AAA040-P11 265
CGBYyyyy Microgenomates bacterium SCGC_AAA011-B20 197
CavYyyy2 Microgenomates bacterium SCGC_AAA011-L05 205
CiPbYyyy Microgenomates bacterium SCGC_AAA011-I21 204
CiriYyyy Microgenomates bacterium SCGC_AAA011-M05 196
CvEYyyy4 Microgenomates bacterium SCGC_AAA011-E14 182
CvmYyyy2 Microgenomates bacterium SCGC_AAA011-A19 193
CavYyyy3 Microgenomates bacterium SCGC_AAA011-L6 266
CvOYyyy6 Microgenomates bacterium SCGC_AAA011-F5 267
CtJYyyyy Microgenomates bacterium SCGC_AAA255-J07 132
ALGYyyyy Nanoarchaeota archaeon SCGC_AAA011-L15 208
CUEYyyy2 Nanoarchaeota archaeon SCGC_AAA011-K22 202
CUnYyyyy Nanoarchaeota archaeon SCGC_AAA011-J02 207
CsUYyyyy Nanoarchaeota archaeon SCGC_AAA011-G17 198
CvUYyyy2 Nanoarchaeota archaeon SCGC_AAA011-L22 192
CUGYyyyy Nanoarchaeota archaeon SCGC_AAA011-D5 270
CavYyyyy Omnitrophica bacterium SCGC_AAA011-L16 184
CvmYyyy3 Omnitrophica bacterium SCGC_AAA011-A17 263
COAYyyy2 Omnitrophica bacterium SCGC_AAA257-O07 147
CGBYyyy3 Omnitrophica bacterium SCGC_AAA252-B19 34
B71Yyyy2 Parcubacteria bacterium SCGC_AAA036-E14 178
B73Yyyyy Parcubacteria bacterium SCGC_AAA040-L21 179
B71Yyyyy Parcubacteria bacterium SCGC_AAA010-E09 100
CGJYyyy2 Parcubacteria bacterium SCGC_AAA011-J21 191
CabYyyy2 Parcubacteria bacterium SCGC_AAA011-A09 189
CabYyyyy Parcubacteria bacterium SCGC_AAA011-A08 185
CivYyyyy Parcubacteria bacterium SCGC_AAA011-N16 262
B72Yyyyy Parcubacteria bacterium SCGC_AAA255-P19 138
B74Yyyyy Parcubacteria bacterium SCGC_AB-164-E21 209
SbDYyyyy Synergistetes bacterium JGI_0000079-D21 233
TmEYyyyy Thaumarchaeota archaeon SCGC_AB-179-E04 221
TSGYyyyy Thaumarchaeota archaeon SCGC_AAA007-O23 783
TrJYyyyy Thermotogae bacterium JGI_0000106-O11 293
CWtYyyyy WS1 bacterium JGI_0000059-K21 168